Résultats 1 à 10

Dates de soutenance :


Etablissements :

Valider et fermer
  • Caen (3)
  • Paris 11 (3)
  • Université Paris-Saclay (ComUE) (3)
  • Normandie (2)
  • Aix-Marseille (1)
  • Bourgogne Franche-Comté (1)
  • Lille 1 (1)
  • Lyon (1)
  • Montpellier (1)
  • Paris Est (1)
  • Poitiers (1)
  • Reims (1)
  • Rennes, Agrocampus Ouest (1)
  • University of Nottingham (1)
  • Università degli studi (Pise, Italie) (1)
  • Université de Lorraine (1)

Etablissements :

Fullscreen

Disciplines :

Valider et fermer
  • Biologie (4)
  • Sciences agronomiques, biotechnologies agro-alimentaires (2)
  • Aspects moléculaires et cellulaires de la biologie (1)
  • Biologie animale et végétale (1)
  • Biologie cellulaire et moléculaire végétales (1)
  • Biologie des organismes ; Biotechnologies Animales, Végétales et Microbiennes (1)
  • Biologie intégrative des plantes (1)
  • Biologie évolutive et Écologie (1)
  • Epidémiologie (1)
  • Mathématiques appliquées (1)
  • Physiologie, biologie des organismes, populations, interactions (1)
  • Physique (1)
  • Sciences agronomiques (1)
  • Sciences agronomiques, biotechnnologies agro-alimentaires (1)
  • Sciences de la Vie (1)
  • Sciences du langage (1)
  • Sciences économiques (1)

Disciplines :

Fullscreen

Ecoles Doctorales :

Valider et fermer
  • École doctorale Normande de biologie intégrative, santé, environnement (Mont-Saint-Aignan, Seine-Maritime) (3)
  • Ecole doctorale Sciences du Végétal (1992-2015 ; Orsay, Essonne) (2)
  • École doctorale Sciences du végétal : du gène à l'écosystème (Orsay, Essonne ; 2015-....) (2)
  • Ecole Doctorale Cognition, Langage et Education (Aix-en-Provence) (1)
  • Ecole doctorale Sciences Fondamentales et Santé (Reims, Marne) (1)
  • SESAMES - Ecole Doctorale Lorraine de Chimie et Physique Moléculaires (1)
  • Systèmes Intégrés en Biologie, Agronomie, Géosciences, Hydrosciences, Environnement (Montpellier ; École Doctorale ; 2009-2015) (1)
  • École Doctorale de Biologie Moléculaire Intégrative et Cellulaire (Lyon) (1)
  • École doctorale Environnements, Santé (Dijon ; Besançon ; 2012-....) (1)
  • École doctorale Santé publique (Paris ; 2000-2015) (1)
  • École doctorale Sciences pour l'environnement - Gay Lussac (La Rochelle ; 2009-2018) (1)
  • École doctorale Ville, Transports et Territoires (Champs-sur-Marne, Seine-et-Marne ; 2015-....) (1)
  • École doctorale de mathématiques Hadamard (Orsay, Essonne ; 2015-....) (1)
  • École doctorale Écologie Géosciences Agronomie Alimentation (Rennes) (1)

Ecoles Doctorales :

Fullscreen

Langues :

Valider et fermer
  • français (16)
  • anglais (6)

Langues :

Fullscreen

Directeurs de thèse :

Valider et fermer
  • Avice Jean-Christophe (2)
  • Etienne Philippe (2)
  • Aubert Dominique (1)
  • Battie Yann (1)
  • Bishopp Anthony (1)
  • Blache Philippe (1)
  • Bouchereau Alain (1)
  • Chaoui Nouari (1)
  • Charles Marie-Aline (1)
  • Cuguen Joël (1)
  • En Naciri Aotmane (1)
  • Favennec Loïc (1)
  • Gakière Bertrand (1)
  • Gallardo Karine (1)
  • Gaubert Stéphane (1)
  • Heude Barbara (1)
  • Hodges Michaël (1)
  • Lainé Philippe (1)
  • Le Dily Frédérik (1)
  • Lemoine Rémi (1)
  • Lenci Alessandro (1)
  • Leurent Fabien (1)
  • Masclaux-Daubresse Céline (1)
  • Morel Jean-Benoît (1)
  • Noctor Graham (1)
  • Oudjane Nadia (1)
  • Pourtau Nathalie (1)
  • Roux Fabrice (1)
  • Vernoud Vanessa (1)
  • Vernoux Teva (1)

Directeurs de thèse :

Fullscreen

Domaines :

Valider et fermer
  • Sciences de la vie, biologie, biochimie (9)
  • Médecine et santé (3)
  • Agronomie, agriculture et médecine vétérinaire (3)
  • Plantes. Botanique (2)
  • Economie (1)
  • Langues et linguistique (1)
  • Mathématiques (1)
  • Physique (1)

Domaines :

Fullscreen

21 thèses pour SAG12

...EXPÉRIMENTATION : ETUDE FONCTIONNELLE DE LA PROTÉASE SAG12...

Accéder en ligne
Sciences agronomiques, biotechnologies agro-alimentaires

Soutenue le 17-12-2018
thèse soutenue

...) (d’apƌğs Gan et Amasino, 1997; Zimmerman et Zentgraf, 2005).Ex: SAG12Chapitre I: Synthèse...

Accéder en ligne

...CCTCCITCGCTGAAGATCTGT qRT-PCR ReverseSAG12-1 et -2 AF089848 GTTTTGTTTAGCCAAAGTCAAACA qRT-PCR ForwardAF089849...

Accéder en ligne

...en moins). De plus, les transcrits du gène SAG12 , codant une cystéine protéase spécifiquement...

Accéder en ligne

...SAg9, SAg10, SAg11 et SAg12 qui corres-pondent aux énergies de 5 mJ, 10 mJ, 15 mJ et 20 m...

Accéder en ligne

...), increased in response to waterde!cit in leaves compared with the control (1.7-fold,P, 0.05; Fig. 4B). SAG12...

Accéder en ligne

Résultats 1 à 10