Résultats 1 à 10

Dates de soutenance :


Etablissements :

Valider et fermer
  • Côte d'Azur (2)
  • Angers (1)
  • Grenoble (1)
  • Grenoble Alpes (1)
  • Paris 11 (1)
  • Paris 5 (1)
  • Paris 6 (1)
  • Paris Saclay (1)
  • Toulouse 3 (1)
  • Tours (1)

Etablissements :

Fullscreen

Disciplines :

Valider et fermer
  • Biologie cellulaire (2)
  • Biologie (1)
  • Biologie cellulaire et moléculaire végétale (1)
  • Cancérologie (1)
  • Génétique (1)
  • Neurobiologie (1)
  • Recherche clinique et thérapeutique (1)
  • Sciences de la Vie et de la Santé (1)
  • Sciences de la vie (1)
  • Sciences de la vie et de la santé (1)

Disciplines :

Fullscreen

Ecoles Doctorales :

Valider et fermer
  • École doctorale Sciences de la vie et de la santé (Sophia Antipolis, Alpes-Maritimes) (2)
  • École doctorale chimie et science du vivant (Grenoble) (2)
  • Ecole doctorale Santé, sciences, technologies (Tours) (1)
  • École Doctorale Biologie Santé Biotechnologies (Toulouse) (1)
  • École doctorale Cerveau, cognition, comportement (Paris) (1)
  • École doctorale Gènes, Génomes, Cellules (Gif-sur-Yvette, Essonne ; 2000-2015) (1)
  • École doctorale Génétique, cellulaire, immunologie, infectiologie et développement (....-2013 ; Paris) (1)
  • École doctorale Structure et Dynamique des Systèmes Vivants (Gif-sur-Yvette, Essonne ; 2015-....) (1)
  • École doctorale Végétal-Environnement-Nutrition-Agro-Alimentaire-Mer (Angers) (1)

Ecoles Doctorales :

Fullscreen

Langues :

Valider et fermer
  • français (8)
  • anglais (4)

Langues :

Fullscreen

Directeurs de thèse :

Valider et fermer
  • Corti Olga (2)
  • Baudier Jacques (1)
  • Boissan Mathieu (1)
  • Brice Alexis (1)
  • Burlat Vincent (1)
  • Courdavault Vincent (1)
  • Delahodde Agnès (1)
  • Delanoue Rénald (1)
  • Favre Gilles (1)
  • Guénal Isabelle (1)
  • Leopold Pierre (1)
  • Logan David (1)
  • Macherel David (1)
  • Olichon Aurélien (1)
  • Peyron Jean-François (1)
  • Saint-Pierre Benoît (1)
  • Schlattner Uwe (1)
  • Tokarska-Schlattner Malgorzata (1)

Directeurs de thèse :

Fullscreen

Domaines :

Valider et fermer
  • Sciences de la vie, biologie, biochimie (8)
  • Médecine et santé (4)

Domaines :

Fullscreen

11 thèses pour Mito-GFP

Sciences de la vie

Soutenue le 22-11-2011
thèse soutenue

...séquence d'adressage à la matrice mitochondriale (UAS-mitoGFP) sur le chromosome II....

Accéder en ligne

...transiently transfected withMito-GFP (Clontech, Mountain View, CA, USA). Forty-eight hours after transfection...

Accéder en ligne

...!broblastsc,d,iLung epithelial cellsc,d,iImagingg,jand "owcytometryMitoGFP, MitoRFP,MitoSOX, andMitotracker; in vitro andin vivo...

Accéder en ligne

...IDImito-for GATCTGATGTCTTCAACTTTGACCACTTCCTATTTTCAAACCATTCTCAAGAGAATCTCC Primer annealing pSCA-cassette-GFPi BglII-SpeI pepIDI-mito-GFP pep...

Accéder en ligne

Résultats 1 à 10