Résultats 1 à 10

Dates de soutenance :


Etablissements :

Valider et fermer
  • Sorbonne Paris Cité (5)
  • Montpellier (3)
  • Paris 10 (2)
  • Paris Sciences et Lettres (2)
  • Université Paris-Saclay (ComUE) (2)
  • Bordeaux (1)
  • Bourgogne Franche-Comté (1)
  • Dijon (1)
  • Grenoble (1)
  • Lyon, INSA (1)
  • Nantes (1)
  • Paris, Muséum national d'histoire naturelle (1)
  • Toulouse 3 (1)

Etablissements :

Fullscreen

Disciplines :

Valider et fermer
  • Immunologie (3)
  • Automatique et informatique appliquée (1)
  • Bio-informatique (1)
  • Biologie Santé (1)
  • Biologie et ecotoxicologie aquatique (1)
  • Droit privé et Sciences Criminelles (1)
  • Epistémologie, histoire des sciences et des techniques (1)
  • Génétique (1)
  • Histoire des sciences et des techniques (1)
  • Micro et nano systèmes (1)
  • Microbiologie-immunologie (1)
  • Mécanique (1)
  • Médecine (1)
  • Météorologie, océanographie, physique de l'environnement (1)
  • Physiologie et biologie des organismes, populations, interactions. Neurosciences (1)
  • Sciences de gestion (1)
  • Sciences de la vie (1)
  • Sciences économiques (1)
  • Traitement du signal et des images (1)
  • Épistémologie, histoire des sciences et des techniques (1)

Disciplines :

Fullscreen

Ecoles Doctorales :

Valider et fermer
  • École doctorale Bio Sorbonne Paris Cité (Paris) (5)
  • EDEG - Economie Gestion (1)
  • Ecole Doctorale Mecanique, Energetique, Genie Civil, Acoustique (MEGA) (Villeurbanne) (1)
  • Ecole doctorale Droit et science politique (Montpellier ; 2015-....) (1)
  • Sciences Chimiques et Biologiques pour la Santé (Montpellier ; Ecole Doctorale ; 2015-....) (1)
  • École doctorale Environnements, Santé (Dijon ; Besançon ; 2012-....) (1)
  • École doctorale Génie électrique, électronique et télécommunications (Toulouse) (1)
  • École doctorale Sciences de la nature et de l'Homme - Évolution et écologie (Paris) (1)
  • École doctorale Sciences des métiers de l'ingénieur (Paris) (1)
  • École doctorale Sciences et technologies de l'information et de la communication (Orsay, Essonne ; 2015-....) (1)
  • École doctorale Sociétés, Espaces, Pratiques, Temps (Dijon ; Besançon ; 2017-....) (1)
  • École doctorale de l'École pratique des hautes études (Paris) (1)
  • École doctorale des Sciences de la vie et de la santé (Bordeaux) (1)
  • École doctorale des sciences de l'environnement d'Île-de-France (Paris ; 1991-....) (1)
  • École doctorale ingénierie pour la santé, la cognition, l'environnement (Grenoble) (1)
  • École doctorale sciences et technologies de l'information et des matériaux (Nantes) (1)
  • École doctorale Économie, organisations, société (Nanterre) (1)

Ecoles Doctorales :

Fullscreen

Langues :

Valider et fermer
  • français (14)
  • anglais (10)

Langues :

Fullscreen

Directeurs de thèse :

Valider et fermer
  • Belot Robert (1)
  • Bensaude-Vincent Bernadette (1)
  • Bernard Cécile (1)
  • Blanco Patrick (1)
  • Broquet Grégoire (1)
  • Brun Xavier (1)
  • Bruneau Catherine (1)
  • Ciais Philippe (1)
  • Crow Yanick J. (1)
  • Duplomb-Jego Laurence (1)
  • Fallery Bernard (1)
  • Fiévé Nicolas (1)
  • Glumineau Alain (1)
  • Gressens Pierre (1)
  • Jouanguy Emmanuelle (1)
  • Le besnerais Guy (1)
  • Mahfoud Jarir (1)
  • Mainguy Daniel (1)
  • Marie Benjamin (1)
  • Plestan Franck (1)
  • Quartier Pierre (1)
  • Rivière Jean-Baptiste (1)
  • Rodhain Florence (1)
  • Rossi Carole (1)
  • Ruemmele Frank (1)
  • Solassol Jérôme (1)
  • Thauvin-Robinet Christel (1)
  • Toussaint Bertrand (1)
  • Vert Jean-Philippe (1)
  • Zinovyev Andrei (1)

Directeurs de thèse :

Fullscreen

Domaines :

Valider et fermer
  • Sciences de la vie, biologie, biochimie (8)
  • Sciences de l'ingénieur (5)
  • Médecine et santé (3)
  • Informatique (2)
  • Philosophie, psychologie (1)
  • Economie (1)
  • Droit (1)
  • Chimie, minéralogie, cristallographie (1)
  • Sciences de la terre (1)
  • Animaux. Zoologie (1)
  • Gestion et organisation de l'entreprise (1)
  • Géographie et histoire (1)

Domaines :

Fullscreen

22 thèses pour LRBA

...TCCACTCCATCCTGAAGGCTANFKBIA cDNA hu-cDNA-NFKBIA-Ex3-6R GAGGGCTGATCCTACCACAA Exons 3-6LRBA Génomique huLRBA-Ex2F...

Accéder en ligne

...the nding.5Bakhtiar et al. LRBA Deciency and Endocrine SymptomsFrontiers in Pediatrics | www...

Accéder en ligne

...<7@LR=B!!9@=SP?A!9=@L?>?BLA6!!"?A! >PS7BRA>?A!
Accéder en ligne

...B543210123coefficientFLNCIQGAP2 SACSUBCNPC1L1 APOBNCOA3 LRBA DSPPRRC2AFigure 2.4 – Genes frequently...

Accéder en ligne

...@I:@MP>?O@>?LQ;?LQ;<]O?LQ;EB^<:EBSFT:LLRBa...

Accéder en ligne

...manifestations either. This is unlike previous reported PIDs, such as FOXP3, LRBA, CTLA-4 deficiencies, who...

Accéder en ligne

...-Herrera, G. et al. Deleterious mutations in LRBA are associated with a syndrome of immune deficiency and...

Accéder en ligne

...13 0,99 8 75 1,00 42 48 1,00 3423266 LPHN2 1 0 509 1,00 93 416 1,00 98 357 1,00 93987 LRBA 36 34...

Accéder en ligne
Physiologie et biologie des organismes, populations, interactions. Neurosciences

Soutenue le 29-05-2017
thèse soutenue

...-2,178 -1,123 Gm6310 Unknown 2,39E-03 -2,187 -1,129 Lrba Mus musculus LPS-responsive beige...

Accéder en ligne

Résultats 1 à 10