Résultats 1 à 10

Dates de soutenance :


Etablissements :

Valider et fermer
  • Sorbonne Paris Cité (15)
  • Université Paris-Saclay (ComUE) (12)
  • Sorbonne université (7)
  • Université Côte d'Azur (ComUE) (6)
  • Université de Lorraine (6)
  • Paris 5 (5)
  • Lyon (4)
  • Montpellier (4)
  • Paris 6 (4)
  • Toulouse 3 (4)
  • Bordeaux (3)
  • Rennes 1 (3)
  • Université libanaise (3)
  • Aix-Marseille (2)
  • Bourgogne Franche-Comté (2)
  • Lille 2 (2)
  • Limoges (2)
  • Nantes (2)
  • Normandie (2)
  • Paris Sciences et Lettres (ComUE) (2)
  • Université Grenoble Alpes (ComUE) (2)
  • Aix-Marseille 2 (1)
  • Bordeaux 1 (1)
  • Clermont Auvergne (1)
  • Compiègne (1)
  • Lyon, École normale supérieure (1)
  • Montpellier 1 (1)
  • Nice (1)
  • Paris 11 (1)
  • Pau (1)
  • Rennes, Agrocampus Ouest (1)
  • Tours (1)
  • Universidad del País Vasco. Facultad de ciencias (1)
  • Université Saint-Joseph (Beyrouth) (1)
  • université Paris-Saclay (1)

Etablissements :

Fullscreen

Disciplines :

Valider et fermer
  • Sciences de la vie et de la santé (17)
  • Aspects moléculaires et cellulaires de la biologie (7)
  • Immunologie (6)
  • Biologie Santé (5)
  • Biologie cellulaire (5)
  • Génétique (4)
  • Biologie cellulaire et moléculaire (3)
  • Interactions moléculaires et cellulaires (3)
  • Aspects moleculaires et cellulaires de la biologie (2)
  • Biochimie, biologie moléculaire et cellulaire (2)
  • Biologie (2)
  • Développement (2)
  • Informatique (2)
  • Neurosciences (2)
  • Physiologie, physiopathologie et thérapeutique (2)
  • Physiopathologie (2)
  • Sciences de la Vie (2)
  • Aspects Moléculaires et Cellulaires de la Biologie (1)
  • Bio-ingénierie et Mathématiques Appliquées : Unité de Recherche Biomécanique et Bio-ingénierie (UMR-7338) (1)
  • Biologie Cellulaire et Physiopathologie (1)
  • Biologie cellulaire et physiopathologie (1)
  • Biologie du développement (1)
  • Biologie du développement et dynamique des cellules souches (1)
  • Biologie et sciences de la santé (1)
  • Biologie moléculaire (1)
  • Biologie moléculaire et cellulaire (1)
  • Biologie, Spécialité Génomique et Bioinformatique (1)
  • Biologie. Génomique et bioinformatique (1)
  • Biologie. Microbiologie (1)
  • Biomédecine (1)
  • Biotechnologie, instrumentation, signal et imagerie pour la biologie, la médecine et l'environnement (1)
  • Cancérologie ; radiothérapie (1)
  • Génomes, épigénomes, destin cellulaire (1)
  • Génomique (1)
  • Génétique et Physiologie (1)
  • Génétique humaine (1)
  • Immunologie et microbiologie (1)
  • Mathématiques (1)
  • Microbiologie cellulaire (1)
  • Médecine, biochimie, biologie cellulaire et moléculaire, physiologie et nutrition (1)
  • Médecine. Oncogenèse (1)
  • Médecine. Oncogénèse (1)
  • Médecine. Pathologie cardiovasculaire (1)
  • Pathologie cardio-vasculaire (1)
  • Pharmacologie (1)
  • Physiologie, Physiopathologie et Thérapeutique (1)
  • Reproduction et développement (1)
  • Sciences agronomiques (1)
  • Sciences de la vie et de la santé. Biologie cellulaire (1)
  • Sciences de la vie et de la santé. Génétique (1)

Disciplines :

Fullscreen

Ecoles Doctorales :

Valider et fermer
  • École doctorale Bio Sorbonne Paris Cité (Paris ; 2014-....) (12)
  • École doctorale Cancérologie : biologie-médecine-santé (Villejuif, Val-de-Marne ; 2015-....) (7)
  • École doctorale Complexité du vivant (Paris) (7)
  • École doctorale Sciences de la vie et de la santé (Sophia Antipolis, Alpes-Maritimes) (7)
  • École doctorale BioSE - Biologie, Santé, Environnement (6)
  • École doctorale physiologie, physiopathologie et thérapeutique (6)
  • Sciences Chimiques et Biologiques pour la Santé (Montpellier ; Ecole Doctorale ; 2015-....) (4)
  • École Doctorale Biologie Santé Biotechnologies (Toulouse) (4)
  • École Doctorale de Biologie Moléculaire Intégrative et Cellulaire (Lyon) (4)
  • Ecole Doctorale Sciences de la Vie et de la Santé (Marseille) (3)
  • École doctorale Biologie-Santé (Rennes) (3)
  • École doctorale Hématologie, oncogenèse et biothérapies (Paris ; 2014-....) (3)
  • École doctorale Sciences de la vie et de la santé (Bordeaux) (3)
  • École doctorale Signalisations et réseaux intégratifs en biologie (Le Kremlin-Bicêtre, Val-de-Marne ; 2015-....) (3)
  • École doctorale Biologie-Santé (Lille) (2)
  • École doctorale Environnements, Santé (Dijon ; Besançon ; 2012-....) (2)
  • École doctorale Génétique, cellulaire, immunologie, infectiologie et développement (Paris ; ....-2013) (2)
  • École doctorale Innovation thérapeutique : du fondamental à l'appliqué (Châtenay-Malabry, Hauts-de-Seine ; 2015-....) (2)
  • École doctorale Normande de biologie intégrative, santé, environnement (Mont-Saint-Aignan, Seine-Maritime) (2)
  • Ecologie Géosciences Agronomie Alimentation (EGAAL) (1)
  • Sciences Chimiques et Biologiques pour la Santé (Montpellier ; Ecole Doctorale ; ....-2014) (1)
  • École Doctorale Neurosciences et Cognition (NSCo) (1)
  • École doctorale 71, Sciences pour l'ingénieur (Compiègne) (1)
  • École doctorale Agriculture, alimentation, biologie, environnement, santé (Paris ; 2015-....) (1)
  • École doctorale Biochimie, biothérapies, biologie moléculaire, infectiologie (Paris ; 2009-2013) (1)
  • École doctorale Biologie et biotechnologie (Paris ; 1997-2014) (1)
  • École doctorale Frontières de l'innovation en recherche et éducation (Paris ; 2006-....) (1)
  • École doctorale Mathématiques et sciences et technologies de l'information et de la communication (Rennes) (1)
  • École doctorale Santé, Sciences Biologiques et Chimie du Vivant (Centre-Val de Loire) (1)
  • École doctorale Sciences Biologiques et Santé (Limoges) (1)
  • École doctorale Signalisations et réseaux intégratifs en biologie (Le Kremlin-Bicêtre, Val-de-Marne ; 2000-2015) (1)
  • École doctorale Vie-Agro-Santé (Rennes) (1)
  • École doctorale biologie-santé - Bio-santé (Limoges ; 2009-2018) (1)
  • École doctorale chimie et science du vivant (Grenoble) (1)
  • École doctorale de mathématiques et informatique (Talence, Gironde) (1)
  • École doctorale des sciences de la vie, santé, agronomie, environnement (Clermont-Ferrand) (1)
  • École doctorale ingénierie pour la santé, la cognition, l'environnement (Grenoble) (1)
  • École doctorale sciences exactes et leurs applications (Pau, Pyrénées Atlantiques) (1)

Ecoles Doctorales :

Fullscreen

Langues :

Valider et fermer
  • français (71)
  • anglais (39)

Langues :

Fullscreen

Directeurs de thèse :

Valider et fermer
  • Boukhobza Taha (2)
  • Colnot Céline (2)
  • Dumond Hélène (2)
  • Jaffredo Thierry (2)
  • Lataillade Jean-Jacques (2)
  • Le Grand Fabien (2)
  • Mallat Ziad (2)
  • Parini Angelo (2)
  • Prats Anne-Catherine (2)
  • Véronique Blanquet (2)
  • Abi Fadel Marianne (1)
  • Abi-Rached Laurent (1)
  • Agnès François (1)
  • Albert Matthew L. (1)
  • Alix-Panabieres Catherine (1)
  • Amigorena Sebastian (1)
  • Assié Guillaume (1)
  • Barrandon Yann (1)
  • Baugé Catherine (1)
  • Benmerah Alexandre (1)
  • Bertolino Philippe (1)
  • Bianchi Arnaud (1)
  • Bikfalvi Andreas (1)
  • Blin-Wakkach Claudine (1)
  • Bohl Delphine (1)
  • Bois Frédéric (1)
  • Bonnefoi Hervé (1)
  • Bouatia Naji Nabila (1)
  • Boumediene Karim (1)
  • Bouton Marie-Christine (1)
  • Béroud Christophe (1)
  • Cassard-Doulcier Anne-Marie (1)
  • Chartier-Harlin Marie-Christine (1)
  • Chauchereau Anne (1)
  • Chinetti-Gbaguidi Giulia (1)
  • Clement Bruno (1)
  • Cossart Pascale (1)
  • Coulouarn Cédric (1)
  • Couty Jean-Pierre (1)
  • Cracowski Jean-Luc (1)
  • Dameron Olivier (1)
  • Davignon Jean-Luc (1)
  • Devaux Yvan (1)
  • Doglio Alain (1)
  • Dupont-Nivet Mathilde (1)
  • Duprez Delphine (1)
  • Entz-Werlé Natacha (1)
  • Fagart Jérôme (1)
  • Feuilloley Marc (1)
  • Fischer Evelyne (1)
  • Fortunel Nicolas (1)
  • Fraboulet Sandrine (1)
  • Fridman Wolf Herman (1)
  • Fromont-Hankard Gaëlle (1)
  • Gabillard Jean-Charles (1)
  • Geigl Eva-Maria (1)
  • Gilgenkrantz Hélène (1)
  • Gimenez-Roqueplo Anne-Paule (1)
  • Grandjean Valérie (1)
  • Grange Thierry (1)
  • Gual Philippe (1)
  • Guglielmi Paul (1)
  • Guillonneau Xavier (1)
  • Guéant-Rodriguez Rosa-Maria (1)
  • Hamon Mélanie (1)
  • Hazzouri Mira (1)
  • Hugnot Jean-Philippe (1)
  • Hulot Jean-Sébastien (1)
  • Ingersoll Molly A. (1)
  • Jariel-Encontre Isabelle (1)
  • Jeanpierre Cécile (1)
  • Kempf Hervé (1)
  • Lapaque Nicolas (1)
  • Le Hir Hervé (1)
  • Legay Claire (1)
  • Liquet Benoit (1)
  • Lombes Marc (1)
  • Loosfelt Hugues (1)
  • Magnol Laetitia (1)
  • Mahon François-Xavier (1)
  • Mahéo Karine (1)
  • Mami-Chouaib Fathia (1)
  • Martin Michèle (1)
  • Mauviel Alain (1)
  • Menu Patrick (1)
  • Mericskay Mathias (1)
  • Mialet-Perez Jeanne (1)
  • Michel Jean-Baptiste (1)
  • Morel Laurent (1)
  • Morillon Antonin (1)
  • Musso Orlando (1)
  • Nikolski Macha (1)
  • Olive Daniel (1)
  • Païdassi Helena (1)
  • Perron Muriel (1)
  • Pinieux Gonzague de (1)
  • Pizard Anne (1)
  • Pourié Grégory (1)
  • Prétet Jean-Luc (1)
  • Rescan Pierre-Yves (1)
  • Reyal Fabien (1)
  • Ricci Jean-Ehrland (1)
  • Rihet Pascal (1)
  • Rostène William (1)
  • Rothhut Bernard (1)
  • Rouleau Matthieu (1)
  • Ruggiero Florence (1)
  • Sabatier Robert (1)
  • Salgado David (1)
  • Sanlaville Damien (1)
  • Schluth-Bolard Caroline (1)
  • Segura Elodie (1)
  • Soncin Fabrice (1)
  • Subtil Agathe (1)
  • Tchenio Thierry (1)
  • Thauvin Christel (1)
  • Thiery Jérôme (1)
  • Théret Nathalie (1)
  • Trichet-Migne Valérie (1)
  • Uzan Georges (1)
  • Varret Mathilde (1)
  • Velot Emilie (1)
  • Verhoeyen Els (1)
  • Verrecchia Franck (1)
  • Viriot Laurent (1)
  • Young Jacques (1)
  • Zeineddine Hassan (1)
  • Zibara Kazem (1)

Directeurs de thèse :

Fullscreen

Domaines :

Valider et fermer
  • Sciences de la vie, biologie, biochimie (63)
  • Médecine et santé (57)
  • Informatique (2)
  • Mathématiques (2)
  • Agronomie, agriculture et médecine vétérinaire (1)

Domaines :

Fullscreen

101 thèses pour "Tgfb2"

...stimulated the expression of genes encoding the secreted proteins Gdf15 and Tgfb2, with a trend for Edn3...

Accéder en ligne

...decrease in the transcript levels of Egr1, Scx, Tnmd, Col1a1, Col1a2 and Tgfb2genes in tension-released C3H...

Accéder en ligne

..., TGFB2, PDGFRA, DUSP8 5444 1 FASLG 4545 5 IL18R1, ETV5, IRF1, IL18RAP, PRF1 4246 5 CCL3, GZMB, IL1R1...

Accéder en ligne
Physiologie, physiopathologie et thérapeutique

Soutenue le 12-12-2018
thèse soutenue

...cytoskeleton proteins. TGFb2, one of the strongest down-regulated genes (Table S7), is a cytokine which can...

Accéder en ligne

...TCGGATACTTCAGCGTCAGGA Tgfb2 for TCCCCTCCGAAAATGCCATC rev ACTCTGCCTTCACCAGATTCG Aqp2 for CGCCATCCTCCATGAGATTA rev...

Accéder en ligne

...6) ; Gata binding protein 2 (GATA2) ; Facteur de croissance transformant beta 2 (TGFB2...

Accéder en ligne

Résultats 1 à 10