Résultats 1 à 10

Dates de soutenance :


Etablissements :

Valider et fermer
  • Sorbonne Paris Cité (6)
  • Paris Saclay (4)
  • Montpellier (3)
  • Grenoble Alpes (2)
  • Paris 5 (2)
  • Bordeaux (1)
  • Clermont Auvergne (1)
  • Dijon (1)
  • Limoges (1)
  • Lyon (1)
  • Nice (1)
  • Toulouse 3 (1)
  • Tours (1)

Etablissements :

Fullscreen

Disciplines :

Valider et fermer
  • Aspects moléculaires et cellulaires de la biologie (4)
  • Génétique (3)
  • Biologie cellulaire (2)
  • Aspects moléculaires et cellulaires de la biologie. Hématologie et oncologie (1)
  • Biologie Santé (1)
  • Biologie cellulaire et moléculaire (1)
  • Biologie du développement (1)
  • Ecologie fonctionnelle (1)
  • Ecophysiologie adaptative (1)
  • Génétique et Physiologie (1)
  • Hématologie et oncologie (1)
  • Infectiologie (1)
  • MBS - Modèles, méthodes et algorithmes en biologie, santé et environnement (1)
  • Microbiologie-immunologie (1)
  • Neurosciences - Neurobiologie (1)
  • Pharmacologie et science du médicament (1)
  • Sciences de la Vie et de la Santé (1)
  • Sciences de la vie (1)
  • Sciences de la vie et de la santé (1)

Disciplines :

Fullscreen

Ecoles Doctorales :

Valider et fermer
  • École doctorale Bio Sorbonne Paris Cité (Paris) (5)
  • École doctorale Cancérologie, Biologie, Médecine, Santé (Villejuif, Val-de-Marne ; 2015-....) (3)
  • GAIA - Biodiversité, Agriculture, Alimentation, Environnement, Terre, Eau (2)
  • Sciences Chimiques et Biologiques pour la Santé (Montpellier ; Ecole Doctorale ; 2015-....) (1)
  • École Doctorale Biologie Santé Biotechnologies (Toulouse) (1)
  • École Doctorale de Biologie Moléculaire Intégrative et Cellulaire (Lyon) (1)
  • École doctorale Biologie et biotechnologie (1997-2014 ; Paris) (1)
  • École doctorale Environnements, Santé (Dijon ; Besançon ; 2012-....) (1)
  • École doctorale Génétique, cellulaire, immunologie, infectiologie et développement (....-2013 ; Paris) (1)
  • École doctorale Hématologie, oncogenèse et biothérapies (Paris) (1)
  • École doctorale Santé, Sciences Biologiques et Chimie du Vivant (Centre-Val de Loire) (1)
  • École doctorale Sciences de la vie et de la santé (Sophia Antipolis, Alpes-Maritimes) (1)
  • École doctorale Signalisations et réseaux intégratifs en biologie (Le Kremlin-Bicêtre, Val-de-Marne ; 2015-....) (1)
  • École doctorale biologie-santé - Bio-santé (Limoges ; 2009-2018) (1)
  • École doctorale chimie et science du vivant (Grenoble) (1)
  • École doctorale des Sciences de la vie et de la santé (Bordeaux) (1)
  • École doctorale des sciences de la vie, santé, agronomie, environnement (Clermont-Ferrand) (1)
  • École doctorale ingénierie pour la santé, la cognition, l'environnement (Grenoble) (1)

Ecoles Doctorales :

Fullscreen

Langues :

Valider et fermer
  • français (21)
  • anglais (7)

Langues :

Fullscreen

Directeurs de thèse :

Valider et fermer
  • Bertherat Jérôme (2)
  • Plo Isabelle (2)
  • Assié Guillaume (1)
  • Batut Julie (1)
  • Blader Patrick (1)
  • Blum Michaël (1)
  • Chauchereau Anne (1)
  • Cucchi-Mouillot Patricia (1)
  • Duplomb-Jego Laurence (1)
  • Essig Marie (1)
  • Fagart Jérôme (1)
  • Fourest-Lieuvin Anne (1)
  • Fürthauer Maximilian (1)
  • Jacobin-Valat Marie-Josée (1)
  • Laumonnier Frédéric (1)
  • Levrero Massimo (1)
  • Lignot Jehan-Hervé (1)
  • Lombes Marc (1)
  • Maire Pascal (1)
  • Marty Isabelle (1)
  • Mayeux Patrick (1)
  • Nebel Catherine (1)
  • Ragazzon Bruno (1)
  • Rivière Jean-Baptiste (1)
  • Solassol Jérôme (1)
  • Soumelis Vassili (1)
  • Thauvin-Robinet Christel (1)
  • Val Pierre (1)
  • Valleix Sophie (1)
  • Villeval Jean-Luc (1)

Directeurs de thèse :

Fullscreen

Domaines :

Valider et fermer
  • Sciences de la vie, biologie, biochimie (17)
  • Médecine et santé (9)
  • Informatique (1)
  • Mathématiques (1)

Domaines :

Fullscreen

25 thèses pour "ATP1A1"

Aspects moléculaires et cellulaires de la biologie

Soutenue le 29-01-2016
thèse soutenue

..., Capizzi and Jameson) with 5-6 independent cultures at the Atp1a1 locus using ouabaïn (2 mM) (*P<0.05). (d...

Accéder en ligne

...Reference KP400258 atp1a1a 1.$Įa F 1.$Įa 5 CCTCAGATGGCAAGGAGAAG CCCTGCTGAGATCGGTTCC 146 1.89 (Blondeau...

Accéder en ligne

...-transporting ATPase 3) (Beuschlein et al., 2013), et ATP1A1, codant la sous-unité α1 de la pompe Na+/K+ (Azizan et al...

Accéder en ligne
Aspects moléculaires et cellulaires de la biologie. Hématologie et oncologie

Soutenue le 25-11-2016
thèse soutenue

...the frequency of spontaneous mutagenesis in theAtp1a1 locus of Tdg−/−MEF cells (without TET2...

Accéder en ligne

...polypeptide (Atp1a1) is critical for lumen expansion to create an osmotic gradient to drive water flow into...

Accéder en ligne

...mutations ont également été identifiées dans les gènes coda nt des ATPases d e typ e P , ATP1 A1 et ATP2 B3...

Accéder en ligne

...) Amplification efficiency atp1a1 ATPase Na+/K+ transporting subunit alpha 1 BT027976 CTGCTGGACGACAACTTTGC...

Accéder en ligne
MBS - Modèles, méthodes et algorithmes en biologie, santé et environnement

Soutenue le 21-12-2017
thèse soutenue

...region with many SNPs correlated with PC1 contains the ATP1A1gene involved in osmoregulation and...

Accéder en ligne

...transcription AREC3 (Cell-type specific ARE binding factor) contrôlait l’expression du gène Atp1a1, de manière...

Accéder en ligne

Résultats 1 à 10