Etude des sequences d'adn cis impliquees dans la regulation du gene mep24 par les androgenes

par Jean-Jacques Lareyre

Thèse de doctorat en Sciences biologiques et fondamentales appliquées. Psychologie

Sous la direction de Jean-Paul Dufaure.

Soutenue en 1996

à Clermont-Ferrand 2 .

    mots clés mots clés

  • Résumé

    Mep24 est une proteine de secretion de la tete de l'epididyme identifiee chez la souris. Elle est apparentee a la famille des glutathion peroxydase (gpx5). Le taux d'accumulation des messagers codant pour cette proteine est regule positivement par les androgenes. Des etudes d'elongation de transcription in vitro realisees sur des noyaux isoles de cellules epididymaires indiquent que cette regulation par les androgenes s'effectue non seulement au niveau transcriptionnel mais egalement au niveau post-transcriptionnel. Le sequencage du gene a permis d'identifier 16 demi-palindromes de type tgtyct susceptibles d'augmenter la transcription du gene en presence d'androgenes. Des transfections transitoires de constructions chimeriques dans les cellules cv1 ont montre la presence d'au moins un element de reponse aux androgenes (are) fonctionnel dans la region 5' flanquante. Des experiences d'empreinte a la dnase i ont permis de localiser cet are gagagagaacatctatcctacca en position -892/-870. Cet are potentiel constitue un palindrome imparfait different du consensus classique des gre car il ne contient que deux paires de bases dans l'espaceur. Le site potentiel de fixation pour le facteur ap1 situe en position -1325/-1319 semble non fonctionnel lors de cotransfections transitoires de constructions chimeriques avec des vecteurs d'expression des proteines jun et fos. Des resultats similaires ont ete obtenus apres traitement des cellules par un ester de phorbol (pma). Des proteines nucleaires de l'epididyme de souris ont la capacite de se fixer sur des motifs gata presents dans la region 5' flanquante au gene mep24. Cependant, l'identification de ces proteines epididymaires doit etre poursuivie. Lors de transfections transitoires en presence d'un vecteur d'expression de la proteine pea3, la transcription du gene mep24 est reprimee d'un facteur 4 lorsque la region -1358/-577 est associee au gene rapporteur cat. Ce fragment comporte deux sites potentiels de fixation pour le facteur pea3

  • Pas de résumé disponible.

Consulter en bibliothèque

La version de soutenance existe sous forme papier


  • Détails : 97 P.
  • Annexes : 295 REF.

Où se trouve cette thèse ?

  • Bibliothèque : Université Clermont Auvergne (Aubière). Bibliothèque Sciences, Technologies et Staps.
  • Accessible pour le PEB
Voir dans le Sudoc, catalogue collectif des bibliothèques de l'enseignement supérieur et de la recherche.