Synthese et etude d'hybridation d'oligo-alpha et d'oligo-beta-desoxyribonucleotides immobilises sur supports

par ROBIN KURFURST

Thèse de doctorat en Sciences biologiques et fondamentales appliquées. Psychologie

Sous la direction de THUONG NGUYEN.

Soutenue en 1990

à Orléans .

    mots clés mots clés


  • Résumé

    Des 20-mere beta-d#5 tcatccacctggcattggac#3# comportant ou non un agent intercalant en 5 et substitues en 3 par un groupe thiophosphate ou amine primaire ou thiol ont ete synthetises par l'intermediaire de differents supports originaux. Ces sequences ont ete immobilisees specifiquement via ces groupements fonctionnels a des membranes nylon diversement activees. L'etude de la reaction d'hybridation sur ces supports a ete realisee par utilisation d'un systeme modele constitue d'une sequence cible 40-mere et d'une sonde marquee enzymatiquement. Ceci montre la formation specifique des hybrides et la sensibilite de la detection est de l'ordre de 1 fmole. La mesure de l'affinite du 20-mere alpha-d#5# caggttacggtcacctact#3 ancre sur une membrane pour une sequence 40-mere cible naturelle a ete realisee par thermoelution. Les resultats laissent envisager la transposition de notre modele d'hybridation aux sondes d'anomerie alpha, resistantes aux nucleases. Des nucleosides modifies, methyl-5 alpha-desoxycytidine, dimethylamino-5 beta-desoxyuridine, ont ete synthetises et incorpores respectivement dans des oligomeres homopyrimidiques. Le remplacement de l'alpha-desoxycytidine par la methyl-5 alpha-desoxycytidine augmente fortement la stabilite de la triple helice formee entre l'oligo-alpha-pyrimidique et les sequences d'adn cible homopurique-homopyrimidique. Ces resultats ouvrent la perspective de la synthese de supports greffes par des sondes alpha-homopyrimidiques qui eviteraient l'etape de denaturation et seraient utilisables en presence d'extraits cellulaires


  • Pas de résumé disponible.

Consulter en bibliothèque

La version de soutenance existe sous forme papier

Informations

  • Annexes : 155 REF

Où se trouve cette thèse ?

  • Bibliothèque : Université d'Orléans. Service commun de la documentation.Section Sciences.
  • Accessible pour le PEB
Voir dans le Sudoc, catalogue collectif des bibliothèques de l'enseignement supérieur et de la recherche.